Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CD300LB-CD300 molecule-like family member b Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD300LB-CD300 molecule-like family member b Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028091 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD300LB |
| Origin species: | Human |
| Product name: | CD300LB-CD300 molecule-like family member b Gene |
| Size: | 2ug |
| Accessions: | BC028091 |
| Gene id: | 124599 |
| Gene description: | CD300 molecule-like family member b |
| Synonyms: | CD300b; CLM-7; CLM7; CMRF35-A2; IREM-3; IREM3; TREM-5; TREM5; CMRF35-like molecule 7; CD300 antigen like family member B; immune receptor expressed on myeloid cells 3; leukocyte mono-Ig-like receptor 5; triggering receptor expressed on myeloid cells 5; CD300 molecule like family member b |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcagaaggtgcaagccagagctcgggcagaacttccagagtgcatctgggatctgcatttgccactggttgcagatcaggcggacgaggagccgggaaggcagagccatgtggctgccccctgctctgctccttctcagcctctcaggctgtttctccatccaaggcccagagtctgtgagagccccagagcaggggtccctgacggttcaatgccactataagcaaggatgggagacctacattaagtggtggtgccgaggggtgcgctgggatacatgcaagatcctcattgaaaccagagggtcggagcaaggagagaagagtgaccgtgtgtccatcaaggacaatcagaaagaccgcacgttcactgtgaccatggaggggctcaggcgagatgacgcagatgtttactggtgtgggattgaaagaagaggacctgaccttgggactcaagtgaaagtgatcgttgacccagagggagcggcttccacaacagcaagctcacctaccaacagcaatatggcagtgttcatcggctcccacaagaggaaccactacatgctcctggtatttgtgaaggtgcccatcttgctcatcttggtcactgccatcctctggttgaaggggtctcagagggtccctgaggagccaggggaacagcctatctacatgaacttctccgaacctctgactaaagacatggccacttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 35, member B1 - secretory carrier membrane protein 3 - PML-RARA regulated adaptor molecule 1 - Fas-activated serine/threonine kinase |