POLD4-polymerase (DNA-directed), delta 4 Gene View larger

POLD4-polymerase (DNA-directed), delta 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLD4-polymerase (DNA-directed), delta 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POLD4-polymerase (DNA-directed), delta 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001334
Product type: DNA & cDNA
Ncbi symbol: POLD4
Origin species: Human
Product name: POLD4-polymerase (DNA-directed), delta 4 Gene
Size: 2ug
Accessions: BC001334
Gene id: 57804
Gene description: polymerase (DNA-directed), delta 4
Synonyms: POLDS; p12; DNA polymerase delta subunit 4; DNA polymerase delta smallest subunit p12; polymerase (DNA) delta 4, accessory subunit; polymerase (DNA-directed), delta 4, accessory subunit; DNA polymerase delta 4, accessory subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccggaagcggctcatcactgattcctacccggttgtgaagaggagggaggggcccgctgggcacagcaagggggagctggcacccgagctaggtctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - deiodinase, iodothyronine, type III
- glucuronidase, beta pseudogene
- cold inducible RNA binding protein
- mitochondrial ribosomal protein S7

Buy POLD4-polymerase (DNA-directed), delta 4 Gene now

Add to cart