Cart 1 Product Products 113,40 € (empty)
-
1 x POLD4-poly...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of MRPS7-mitochondrial ribosomal protein S7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS7-mitochondrial ribosomal protein S7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000241 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS7 |
| Origin species: | Human |
| Product name: | MRPS7-mitochondrial ribosomal protein S7 Gene |
| Size: | 2ug |
| Accessions: | BC000241 |
| Gene id: | 51081 |
| Gene description: | mitochondrial ribosomal protein S7 |
| Synonyms: | MRP-S; MRP-S7; RP-S7; RPMS7; S7mt; bMRP27a; 28S ribosomal protein S7, mitochondrial; 30S ribosomal protein S7 homolog; bMRP-27a; mitochondrial ribosomal protein S7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttgcccccgcagtgaaggttgcccgaggatggtcgggcctggcgttgggcgtgcggcgggctgtcttgcagcttccagggctaactcaggtgagatggagccgctatagtcctgaattcaaggatcccttgattgacaaggaatattatcgcaagccagtggaggagctaactgaggaggagaaatatgttcgggagctcaagaagactcagctcatcaaagctgctccagcagggaaaacaagttctgtgtttgaagacccagtcatcagtaaattcaccaacatgatgatgataggaggaaacaaagtactggccagatccctcatgattcagactctggaagctgtgaaaaggaagcagtttgagaagtaccatgccgcttctgcagaggaacaggcaaccatcgaacgcaacccctacaccatcttccatcaagcactgaaaaactgtgagcctatgattgggctggtacccatcctcaagggaggccgtttctaccaggtccctgtacccctacccgaccggcgtcgccgcttcctagccatgaagtggatgatcactgagtgccgggataaaaagcaccagcggacactgatgccggagaagctgtcacacaagctgctggaggctttccataaccagggccccgtgatcaagaggaagcatgacttgcacaagatggcagaggccaaccgtgccctggcccactaccgctggtggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat containing 18 - mitochondrial ribosomal protein L4 - HLA-B associated transcript 2-like - pirin (iron-binding nuclear protein) |