LOC284912-hypothetical gene supported by BC001801 Gene View larger

LOC284912-hypothetical gene supported by BC001801 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC284912-hypothetical gene supported by BC001801 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC284912-hypothetical gene supported by BC001801 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001801
Product type: DNA & cDNA
Ncbi symbol: LOC284912
Origin species: Human
Product name: LOC284912-hypothetical gene supported by BC001801 Gene
Size: 2ug
Accessions: BC001801
Gene id: 284912
Gene description: hypothetical gene supported by BC001801
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacttctcagcccacaatcacccttcagggtagaccgaggagagcacctccccttcctggtgaagggagcccgatacacgctggtgccggctggccaagaaggaggtggacaaacctggcgaccgctccctggcaccacctcaccagaggacagctcacacctccacaggggtcagaagaaaggagctgccctggggatggctgtgtatccctacaactgccaggcacatgccccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endothelial differentiation-related factor 1
- eukaryotic translation initiation factor 5A
- nucleolar and spindle associated protein 1
- translocation associated membrane protein 2

Buy LOC284912-hypothetical gene supported by BC001801 Gene now

Add to cart