PTXBC015500
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015500 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EDF1 |
| Origin species: | Human |
| Product name: | EDF1-endothelial differentiation-related factor 1 Gene |
| Size: | 2ug |
| Accessions: | BC015500 |
| Gene id: | 8721 |
| Gene description: | endothelial differentiation-related factor 1 |
| Synonyms: | CFAP280; EDF-1; MBF1; endothelial differentiation-related factor 1; multiprotein bridging factor 1; endothelial differentiation related factor 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgagagcgactgggacacggtgacggtgctgcgcaagaagggccctacggccgcccaggccaaatccaagcaggctatcttagcggcacagagacgaggagaagatgtggagacttccaagaaatgggctgctggccagaacaaacaacattctattaccaagaacacggccaagctggaccgggagacagaggagctgcaccatgacagggtgaccctggaggtgggcaaggtgatccagcaaggtcggcagagcaaggggcttacgcagaaggacctggccacgaaaatcaatgagaagccacaggtgatcgcggactatgagagcggacgggccatacccaataaccaggtgcttggcaaaatcgagcgggccattggcctcaagctccggggaaaggacattggaaagcccatcgagaaggggcctagggcgaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 5A - nucleolar and spindle associated protein 1 - translocation associated membrane protein 2 - WW domain containing adaptor with coiled-coil |