C10orf116-chromosome 10 open reading frame 116 Gene View larger

C10orf116-chromosome 10 open reading frame 116 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf116-chromosome 10 open reading frame 116 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf116-chromosome 10 open reading frame 116 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004471
Product type: DNA & cDNA
Ncbi symbol: C10orf116
Origin species: Human
Product name: C10orf116-chromosome 10 open reading frame 116 Gene
Size: 2ug
Accessions: BC004471
Gene id: 10974
Gene description: chromosome 10 open reading frame 116
Synonyms: C10orf116; AFRO; APM2; apM-2; adipogenesis regulatory factor; adipogenesis factor rich in obesity; adipose most abundant gene transcript 2 protein; adipose specific 2; adipose-specific protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaagcaagggcttgcaggacctgaagcaacaggtggaggggaccgcccaggaagccgtgtcagcggccggagcggcagctcagcaagtggtggaccaggccacagaggcggggcagaaagccatggaccagctggccaagaccacccaggaaaccatcgacaagactgctaaccaggcctctgacaccttctctgggatcgggaaaaaattcggcctcctgaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 27-like
- phosphoprotein enriched in astrocytes 15
- chromosome 20 open reading frame 149
- chromosome 21 open reading frame 121

Buy C10orf116-chromosome 10 open reading frame 116 Gene now

Add to cart