FAM27L-family with sequence similarity 27-like Gene View larger

FAM27L-family with sequence similarity 27-like Gene

PTXBC031617

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM27L-family with sequence similarity 27-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM27L-family with sequence similarity 27-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031617
Product type: DNA & cDNA
Ncbi symbol: FAM27L
Origin species: Human
Product name: FAM27L-family with sequence similarity 27-like Gene
Size: 2ug
Accessions: BC031617
Gene id: 284123
Gene description: family with sequence similarity 27-like
Synonyms: family with sequence similarity 27-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgttcgggatcaagatgaccacactccagccaaggataaaagccccacaggagctcactgtcctgcaggagaggagcaggcccacgtccaagaagatggctgtatgttttcacggctcttctctgagaagtgaagccacaccacgatacagtcttgaagaggaagccgggaatgggagatggcaacaagccctgtcatggtggcctctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoprotein enriched in astrocytes 15
- chromosome 20 open reading frame 149
- chromosome 21 open reading frame 121
- C-type lectin domain family 2, member D

Buy FAM27L-family with sequence similarity 27-like Gene now

Add to cart