CD52-CD52 molecule Gene View larger

CD52-CD52 molecule Gene

PTXBC000644

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD52-CD52 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD52-CD52 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000644
Product type: DNA & cDNA
Ncbi symbol: CD52
Origin species: Human
Product name: CD52-CD52 molecule Gene
Size: 2ug
Accessions: BC000644
Gene id: 1043
Gene description: CD52 molecule
Synonyms: CD52 molecule; CD52 antigen (CAMPATH-1 antigen); CDW52; CAMPATH-1 antigen; CDW52 antigen (CAMPATH-1 antigen); HEL-S-171mP; cambridge pathology 1 antigen; epididymal secretory protein E5; epididymis secretory sperm binding protein Li 171mP; he5; human epididymis-specific protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcgcttcctcttcctcctactcaccatcagcctcctggttatggtacagatacaaactggactctcaggacaaaacgacaccagccaaaccagcagcccctcagcatccagcagcatgagcggaggcattttccttttcttcgtggccaatgccataatccacctcttctgcttcagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuropeptide Y
- COBL-like 1
- CD1a molecule
- CD70 molecule

Buy CD52-CD52 molecule Gene now

Add to cart