Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD52-CD52 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD52-CD52 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000644 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD52 |
| Origin species: | Human |
| Product name: | CD52-CD52 molecule Gene |
| Size: | 2ug |
| Accessions: | BC000644 |
| Gene id: | 1043 |
| Gene description: | CD52 molecule |
| Synonyms: | CD52 molecule; CD52 antigen (CAMPATH-1 antigen); CDW52; CAMPATH-1 antigen; CDW52 antigen (CAMPATH-1 antigen); HEL-S-171mP; cambridge pathology 1 antigen; epididymal secretory protein E5; epididymis secretory sperm binding protein Li 171mP; he5; human epididymis-specific protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcgcttcctcttcctcctactcaccatcagcctcctggttatggtacagatacaaactggactctcaggacaaaacgacaccagccaaaccagcagcccctcagcatccagcagcatgagcggaggcattttccttttcttcgtggccaatgccataatccacctcttctgcttcagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neuropeptide Y - COBL-like 1 - CD1a molecule - CD70 molecule |