Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD70-CD70 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD70-CD70 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000725 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD70 |
| Origin species: | Human |
| Product name: | CD70-CD70 molecule Gene |
| Size: | 2ug |
| Accessions: | BC000725 |
| Gene id: | 970 |
| Gene description: | CD70 molecule |
| Synonyms: | CD70 molecule; surface antigen CD70; CD70 antigen; CD27-L; CD27L; CD27LG; TNFSF7; TNLG8A; CD27 ligand; Ki-24 antigen; tumor necrosis factor ligand 8A; tumor necrosis factor ligand superfamily member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggaggagggttcgggctgctcggtgcggcgcaggccctatgggtgcgtcctgcgggctgctttggtcccattggtcgcgggcttggtgatctgcctcgtggtgtgcatccagcgcttcgcacaggctcagcagcagctgccgctcgagtcacttgggtgggacgtagctgagctgcagctgaatcacacaggacctcagcaggaccccaggctatactggcaggggggcccagcactgggccgctccttcctgcatggaccagagctggacaaggggcagctacgtatccatcgtgatggcatctacatggtacacatccaggtgacgctggccatctgttcctccacgacggcctccaggcaccaccccaccaccctggccgtgggaatctgctctcccgcctcccgtagcatcagcctgctgcgtctcagcttccaccaaggttgtaccattgcctcccagcgcctgacgcccctggcccgaggggacacactctgcaccaacctcactgggacacttttgccttcccgaaacactgatgagaccttctttggagtgcagtgggtgcgcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAD52 motif 1 - TRK-fused gene - CD93 molecule - ets variant 4 |