Login to display prices
Login to display prices
SH2B3-SH2B adaptor protein 3 Gene View larger

SH2B3-SH2B adaptor protein 3 Gene

PTXBC015786

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH2B3-SH2B adaptor protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SH2B3-SH2B adaptor protein 3 Gene

Proteogenix catalog: PTXBC015786
Ncbi symbol: SH2B3
Product name: SH2B3-SH2B adaptor protein 3 Gene
Size: 2ug
Accessions: BC015786
Gene id: 10019
Gene description: SH2B adaptor protein 3
Synonyms: IDDM20; LNK; SH2B adapter protein 3; lymphocyte-specific adapter protein Lnk; signal transduction protein Lnk; SH2B adaptor protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtttctcttgtcaaccgggctggagtgcagtggtgcaatcttggctcactgcaacctccaccttcctggttcaagcgattctgcctcgacctctcaagtagctgggattacaagcaccagccaccatgcctggctaattttgtatttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: