TPSAB1-tryptase alpha/beta 1 Gene View larger

TPSAB1-tryptase alpha/beta 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPSAB1-tryptase alpha/beta 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPSAB1-tryptase alpha/beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028059
Product type: DNA & cDNA
Ncbi symbol: TPSAB1
Origin species: Human
Product name: TPSAB1-tryptase alpha/beta 1 Gene
Size: 2ug
Accessions: BC028059
Gene id: 7177
Gene description: tryptase alpha/beta 1
Synonyms: TPS1; TPS2; TPSB1; tryptase alpha/beta-1; mast cell alpha II tryptase; mast cell beta I tryptase; tryptase alpha II; tryptase alpha-1; tryptase beta I; tryptase beta-1; tryptase-1; tryptase-I; tryptase-III; tryptase alpha/beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgagcctgctgctgctggcgctgcccgtcctggcgagcccggcctacgcggcccctgccccagtccaggccctgcagcaagcgggtatcgtcgggggtcaggaggcccccaggagcaagtggccctggcaggtgagcctgagagtccgcgaccgatactggatgcacttctgtgggggctccctcatccacccccagtgggtgctgaccgcggcgcactgcctgggaccggacgtcaaggatctggccaccctcagggtgcaactgcgggagcagcacctctactaccaggaccagctgctgccggtcagcaggatcatcgtgcacccacagttctacatcatccagactggagcggatatcgccctgctggagctggaggagcccgtgaacatctccagccgcgtccacacggtcatgctgccccctgcctcggagaccttccccccggggatgccgtgctgggtcactggctggggcgatgtggacaatgatgagcccctcccaccgccatttcccctgaagcaggtgaaggtccccataatggaaaaccacatttgtgacgcaaaataccaccttggcgcctacacgggagacgacgtccgcatcatccgtgacgacatgctgtgtgccgggaacacccggagggactcatgccagggcgactctggagggcccctggtgtgcaaggtgaatggcacctggctacaggcgggcgtggtcagctgggacgagggctgtgcccagcccaaccggcctggcatctacacccgtgtcacctactacttggactggatccaccactatgtccccaaaaagccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HD domain containing 3
- ring finger protein 11
- metastasis associated 1
- ELL associated factor 2

Buy TPSAB1-tryptase alpha/beta 1 Gene now

Add to cart