C22orf39-chromosome 22 open reading frame 39 Gene View larger

C22orf39-chromosome 22 open reading frame 39 Gene

PTXBC030758

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C22orf39-chromosome 22 open reading frame 39 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C22orf39-chromosome 22 open reading frame 39 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030758
Product type: DNA & cDNA
Ncbi symbol: C22orf39
Origin species: Human
Product name: C22orf39-chromosome 22 open reading frame 39 Gene
Size: 2ug
Accessions: BC030758
Gene id: 128977
Gene description: chromosome 22 open reading frame 39
Synonyms: UPF0545 protein C22orf39; chromosome 22 open reading frame 39
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacggcagcggctggcagccgccgcgcccctgcgaggcctaccgcgccgagtggaagctctgccgcagcgccaggcacttcctacaccactactacgtccacggcgagcggccggcctacgaacagtggcagcgcgacctggccagctgccgcgactgggaggagcgccggaacgccgaggcccaggtgctaagtgtggtggctcacacctgtaatctcagctacttgggaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - karyopherin alpha 4 (importin alpha 3)
- chromosome 22 open reading frame 13
- chromosome 11 open reading frame 64
- chromosome 19 open reading frame 48

Buy C22orf39-chromosome 22 open reading frame 39 Gene now

Add to cart