KPNA4-karyopherin alpha 4 (importin alpha 3) Gene View larger

KPNA4-karyopherin alpha 4 (importin alpha 3) Gene

PTXBC016754

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KPNA4-karyopherin alpha 4 (importin alpha 3) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KPNA4-karyopherin alpha 4 (importin alpha 3) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016754
Product type: DNA & cDNA
Ncbi symbol: KPNA4
Origin species: Human
Product name: KPNA4-karyopherin alpha 4 (importin alpha 3) Gene
Size: 2ug
Accessions: BC016754
Gene id: 3840
Gene description: karyopherin alpha 4 (importin alpha 3)
Synonyms: IPOA3; QIP1; SRP3; importin subunit alpha-3; importin alpha Q1; importin subunit alpha-4; karyopherin alpha 4 (importin alpha 3); karyopherin subunit alpha 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaacaaagactggtttagcagcagacattggtttactctgcagcctgtgttttctgtttccccctttcccacctccttccccccacccaatccttttttttttcttttttgcttttcttttctttttttttagtttttatttactttacctagtatgcctttttttagttgcttctcaagtcagaaaacttttcaggaaggtttccctgtgcatttgcaccagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 22 open reading frame 13
- chromosome 11 open reading frame 64
- chromosome 19 open reading frame 48
- chromosome 1 open reading frame 212

Buy KPNA4-karyopherin alpha 4 (importin alpha 3) Gene now

Add to cart