MTCP1-mature T-cell proliferation 1 Gene View larger

MTCP1-mature T-cell proliferation 1 Gene

PTXBC002600

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTCP1-mature T-cell proliferation 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTCP1-mature T-cell proliferation 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002600
Product type: DNA & cDNA
Ncbi symbol: MTCP1
Origin species: Human
Product name: MTCP1-mature T-cell proliferation 1 Gene
Size: 2ug
Accessions: BC002600
Gene id: 4515
Gene description: mature T-cell proliferation 1
Synonyms: P13MTCP1; p8MTCP1; protein p13 MTCP-1; MTCP-1 type B1; mature T-cell proliferation 1 isoform p13; mature T-cell proliferation-1 type B1; mature T-cell proliferation 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcagaaggatccgtgccagaagcaagcctgtgagatacagaaatgtttacaagccaacagctacatggaatcaaagtgtcaggctgtcatccaagaactgcgtaagtgttgtgctcagtatcccaagggaagatctgtcgtctgttcaggatttgaaaaagaagaggaagaaaacctaacacggaagtctgcatcaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arylsulfatase family, member J
- 5', 3'-nucleotidase, cytosolic
- histone cluster 2, H2aa4
- 5', 3'-nucleotidase, cytosolic

Buy MTCP1-mature T-cell proliferation 1 Gene now

Add to cart