ARSJ-arylsulfatase family, member J Gene View larger

ARSJ-arylsulfatase family, member J Gene

PTXBC032010

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARSJ-arylsulfatase family, member J Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARSJ-arylsulfatase family, member J Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032010
Product type: DNA & cDNA
Ncbi symbol: ARSJ
Origin species: Human
Product name: ARSJ-arylsulfatase family, member J Gene
Size: 2ug
Accessions: BC032010
Gene id: 79642
Gene description: arylsulfatase family, member J
Synonyms: arylsulfatase J; ASJ; arylsulfatase family member J
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcctgggcagcaggctatgggatctggaacactgcaatccagtcagccatcagagtgcagcactggaaattgcttacaggaaatcctggctacagcgactgggtcccccctcagtctttcagcaacctgggaccgaaccggtggcacaatgaacggatcaccttgtcaactggcaaaagtgtatggcttttcaacatcacagccgacccatatgagagggtggacctatctaacaggtatccaggaatcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 5', 3'-nucleotidase, cytosolic
- histone cluster 2, H2aa4
- 5', 3'-nucleotidase, cytosolic
- rhomboid domain containing 2

Buy ARSJ-arylsulfatase family, member J Gene now

Add to cart