Login to display prices
Login to display prices
TAP1-transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Gene View larger

TAP1-transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Gene


New product

Data sheet of TAP1-transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TAP1-transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014081
Product type: DNA & cDNA
Ncbi symbol: TAP1
Origin species: Human
Product name: TAP1-transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Gene
Size: 2ug
Accessions: BC014081
Gene id: 6890
Gene description: transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms: peptide transporter TAP1; TAP1*0102N; ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1N; antigen peptide transporter 1; ABC transporter, MHC 1; ATP-binding cassette sub-family B member 2; ATP-binding cassette, sub-family B (MDR/TAP), member 2; peptide supply factor 1; peptide transporter PSF1; peptide transporter involved in antigen processing 1; really interesting new gene 4 protein; transporter 1 ATP-binding cassette sub-family B; transporter 1, ATP-binding cassette, sub-family B (MDR/TAP); transporter associated with antigen processing; transporter, ATP-binding cassette, major histocompatibility complex, 1; transporter 1, ATP binding cassette subfamily B member
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagcttctcgccagcgcaggatcagcctgttcctgggactttccgagagccccgccctcgttccctcccccagccgccagtaggggaggactcggcggtacccggagcttcaggccccaccggggcgcggagagtcccaggcccggccgggaccgggacggcgtccgagtgccaatggctagctctaggtgtcccgctccccgcgggtgccgctgcctccccggagcttctctcgcatggctggggacagtactgctacttctcgccgactgggtgctgctccggaccgcgctgccccgcatattctccctgctggtgcccaccgcgctgccactgctccgggtctgggcggtgggcctgagccgctgggccgtgctctggctgggggcctgcggggtcctcagggcaacggttggctccaagagcgaaaacgcaggtgcccagggctggctggctgctttgaagccattagctgcggcactgggcttggccctgccgggacttgccttgttccgagagctgatctcatggggagcccccgggtccgcggatagcaccaggctactgcactggggaagtcaccctaccgccttcgttgtcagttatgcagcggcactgcccgcagcagccctgtggcacaaactcgggagcctctgggtgcccggcggtcagggcggctctggaaaccctgtgcgtcggcttctaggctgcctgggctcggagacgcgccgcctctcgctgttcctggtcctggtggtcctctcctctcttggggagatggccattccattctttacgggccgcctcactgactggattctacaagatggctcagccgataccttcactcgaaacttaactctcatgtccattctcaccatagccagtgcagtgctggagttcgtgggtgacgggatctataacaacaccatgggccacgtgcacagccacttgcagggagaggtgtttggggctgtcctgcgccaggagacggagtttttccaacagaaccagacaggtaacatcatgtctcgggtaacagaggacacgtccaccctgagtgattctctgagtgagaatctgagcttatttctgtggtacctggtgcgaggcctatgtctcttggggatcatgctctggggatcagtgtccctcaccatggtcaccctgatcaccctgcctctgcttttccttctgcccaagaaggtgggaaaatggtaccagttgctggaagtgcaggtgcgggaatctctggcaaagtccagccaggtggccattgaggctctgtcggccatgcctacagttcgaagctttgccaacgaggagggcgaagcccagaagtttagggaaaagctgcaagaaataaagacactcaaccagaaggaggctgtggcctatgcagtcaactcctggaccactagtatttcaggtatgctgctgaaagtgggaatcctctacattggtgggcagctggtgaccagtggggctgtaagcagtgggaaccttgtcacatttgttctctaccagatgcagttcacccaggctgtggaggtactgctctccatctaccccagagtacagaaggctgtgggctcctcagagaaaatatttgagtacctggaccgcacccctcgctgcccacccagtggtctgttgactcccttacacttggagggccttgtccagttccaagatgtctcctttgcctacccaaaccgcccagatgtcttagtgctacaggggctgacattcaccctacgccctggcgaggtgacggcgctggtgggacccaatgggtctgggaagagcacagtggctgccctgctgcagaatctgtaccagcccaccgggggacagctgctgttggatgggaagccccttccccaatatgagcaccgctacctgcacaggcaggtggctgcagtgggacaagagccacaggtatttggaagaagtcttcaagaaaatattgcctatggcctgacccagaagccaactatggaggaaatcacagctgctgcagtaaagtctggggcccatagtttcatctctggactccctcagggctatgacacagaggtagacgaggctgggagccagctgtcagggggtcagcgacaggcagtggcgttggcccgagcattgatccggaaaccgtgtgtacttatcctggatgatgccaccagtgccctggatgcaaacagccagttacaggtggagcagctcctgtacgaaagccctgagcggtactcccgctcagtgcttctcatcacccagcacctcagcctggtggagcaggctgaccacatcctctttctggaaggaggcgctatccgggaggggggaacccaccagcagctcatggagaaaaaggggtgctactgggccatggtgcaggctcctgcagatgctccagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+/K+ transporting, nongastric, alpha polypeptide
- platelet-derived growth factor receptor, beta polypeptide
- DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
- transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)