TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene View larger

TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017754
Product type: DNA & cDNA
Ncbi symbol: TFAP2A
Origin species: Human
Product name: TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene
Size: 2ug
Accessions: BC017754
Gene id: 7020
Gene description: transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Synonyms: AP-2alpha; AP2TF; BOFS; TFAP2; transcription factor AP-2-alpha; AP-2 transcription factor; AP2-alpha; activating enhancer-binding protein 2-alpha; activator protein 2; transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha); transcription factor AP-2 alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttagttcacagtttttcagccatggaccgtcacgacggcaccagcaacgggacggcacggttgccccagctgggcactgtaggtcaatctccctacacgagcgccccgccgctgtcccacacccccaatgccgacttccagcccccatacttccccccaccctaccagcctatctacccccagtcgcaagatccttactcccacgtcaacgacccctacagcctgaaccccctgcacgcccagccgcagccgcagcacccaggctggcccggccagaggcagagccaggagtctgggctcctgcacacgcaccgggggctgcctcaccagctgtcgggcctggatcctcgcagggactacaggcggcacgaggacctcctgcacggcccacacgcgctcagctcaggactcggagacctctcgatccactccttacctcacgccatcgaggaggtcccgcatgtagaagacccgggtattaacatcccagatcaaactgtaattaagaaaggccccgtgtccctgtccaagtccaacagcaatgccgtctccgccatccctattaacaaggacaacctcttcggcggcgtggtgaaccccaacgaagtcttctgttcagttccgggtcgcctctcgctcctcagctccacctcgaagtacaaggtcacggtggcggaagtgcagcggcggctctcaccacccgagtgtctcaacgcgtcgctgctgggcggagtgctccggagggcgaagtctaaaaatggaggaagatctttaagagaaaaactggacaaaataggattaaatctgcctgcagggagacgtaaagctgccaacgttaccctgctcacatcactagtagagggagaagctgtccacctagccagggactttgggtacgtgtgcgaaaccgaatttcctgccaaagcagtagctgaatttctcaaccgacaacattccgatcccaatgagcaagtgacaagaaaaaacatgctcctggctacaaaacagatatgcaaagagttcaccgacctgctggctcaggaccgatctcccctggggaactcacggcccaaccccatcctggagcccggcatccagagctgcttgacccacttcaacctcatctcccacggcttcggcagccccgcggtgtgtgccgcggtcacggccctgcagaactatctcaccgaggccctcaaggccatggacaaaatgtacctcagcaacaaccccaatagccacacggacaacaacgccaaaagcagtgacaaagaggagaagcacagaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
- pleckstrin homology domain containing, family H (with MyTH4 domain) member 3
- DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
- DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)

Buy TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene now

Add to cart