Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene
PTXBC017754
New product
Data sheet of TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017754 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TFAP2A |
| Origin species: | Human |
| Product name: | TFAP2A-transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) Gene |
| Size: | 2ug |
| Accessions: | BC017754 |
| Gene id: | 7020 |
| Gene description: | transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) |
| Synonyms: | AP-2alpha; AP2TF; BOFS; TFAP2; transcription factor AP-2-alpha; AP-2 transcription factor; AP2-alpha; activating enhancer-binding protein 2-alpha; activator protein 2; transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha); transcription factor AP-2 alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttagttcacagtttttcagccatggaccgtcacgacggcaccagcaacgggacggcacggttgccccagctgggcactgtaggtcaatctccctacacgagcgccccgccgctgtcccacacccccaatgccgacttccagcccccatacttccccccaccctaccagcctatctacccccagtcgcaagatccttactcccacgtcaacgacccctacagcctgaaccccctgcacgcccagccgcagccgcagcacccaggctggcccggccagaggcagagccaggagtctgggctcctgcacacgcaccgggggctgcctcaccagctgtcgggcctggatcctcgcagggactacaggcggcacgaggacctcctgcacggcccacacgcgctcagctcaggactcggagacctctcgatccactccttacctcacgccatcgaggaggtcccgcatgtagaagacccgggtattaacatcccagatcaaactgtaattaagaaaggccccgtgtccctgtccaagtccaacagcaatgccgtctccgccatccctattaacaaggacaacctcttcggcggcgtggtgaaccccaacgaagtcttctgttcagttccgggtcgcctctcgctcctcagctccacctcgaagtacaaggtcacggtggcggaagtgcagcggcggctctcaccacccgagtgtctcaacgcgtcgctgctgggcggagtgctccggagggcgaagtctaaaaatggaggaagatctttaagagaaaaactggacaaaataggattaaatctgcctgcagggagacgtaaagctgccaacgttaccctgctcacatcactagtagagggagaagctgtccacctagccagggactttgggtacgtgtgcgaaaccgaatttcctgccaaagcagtagctgaatttctcaaccgacaacattccgatcccaatgagcaagtgacaagaaaaaacatgctcctggctacaaaacagatatgcaaagagttcaccgacctgctggctcaggaccgatctcccctggggaactcacggcccaaccccatcctggagcccggcatccagagctgcttgacccacttcaacctcatctcccacggcttcggcagccccgcggtgtgtgccgcggtcacggccctgcagaactatctcaccgaggccctcaaggccatggacaaaatgtacctcagcaacaaccccaatagccacacggacaacaacgccaaaagcagtgacaaagaggagaagcacagaaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 - pleckstrin homology domain containing, family H (with MyTH4 domain) member 3 - DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) - DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) |