PAK7-p21 protein (Cdc42/Rac)-activated kinase 7 Gene View larger

PAK7-p21 protein (Cdc42/Rac)-activated kinase 7 Gene


New product

Data sheet of PAK7-p21 protein (Cdc42/Rac)-activated kinase 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PAK7-p21 protein (Cdc42/Rac)-activated kinase 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024179
Product type: DNA & cDNA
Ncbi symbol: PAK7
Origin species: Human
Product name: PAK7-p21 protein (Cdc42/Rac)-activated kinase 7 Gene
Size: 2ug
Accessions: BC024179
Gene id: 57144
Gene description: p21 protein (Cdc42/Rac)-activated kinase 7
Synonyms: serine/threonine-protein kinase PAK7; PAK7; serine/threonine-protein kinase PAK 5; PAK-5; PAK-7; p21 (RAC1) activated kinase 7; p21 protein (Cdc42/Rac)-activated kinase 7; p21(CDKN1A)-activated kinase 7; p21-activated kinase 5; p21-activated kinase 7; p21CDKN1A-activated kinase 7; protein kinase PAK5; serine/threonine-protein kinase PAK 7; p21 (RAC1) activated kinase 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttgggaagaaaaagaaaaagattgaaatatctggcccgtccaactttgaacacagggttcatactgggtttgatgcacaagagcagaagtttaccggccttccccagcagtggcacagcctgttagcagatacggccaacaggccaaagcctatggtggacccttcatgcatcacacccatccagctggctcctatgaagacaatcgttagaggaaacaaaccctgcaaggaaacctccatcaacggcctgctagaggattttgacaacatctcggtgactcgctccaactccctaaggaaagaaagcccacccaccccagatcagggagcctccagccacggtccaggccacgcggaagaaaatggcttcatcaccttctcccagtattccagcgaatccgatactactgctgactacacgaccgaaaagtacagggagaagagtctctatggagatgatctggatccgtattatagaggcagccacgcagccaagcaaaatgggcacgtaatgaaaatgaagcacggggaggcctactattctgaggtgaagcctttgaaatccgattttgccagattttctgccgattatcactcacatttggactcactgagcaaaccaagtgaatacagtgacctcaagtgggagtatcagagagcctcgagtagctcccctctggattattcattccaattcacaccttctagaactgcagggaccagcgggtgctccaaggagagcctggcgtacagtgaaagtgaatggggacccagcctggatgactatgacaggaggccaaagtcttcgtacctgaatcagacaagccctcagcccaccatgcggcagaggtccaggtcaggctcgggactccaggaaccgatgatgccatttggagcaagtgcatttaaaacccatccccaaggacactcctacaactcctacacctaccctcgcttgtccgagcccacaatgtgcattccaaaggtggattacgatcgagcacagatggtcctcagccctccactgtcagggtctgacacctaccccaggggccctgccaaactacctcaaagtcaaagcaaatcgggctattcctcaagcagtcaccagtacccgtctgggtaccacaaagccaccttgtaccatcacccctccctgcagagcagttcgcagtacatctccacggcttcctacctgagctacctcagcctctcatccagcacctacccgccgcccagctggggctcctcctccgaccagcagccctccagggtgtcccatgaacagtttcgggcggccctgcagctggtggtcagcccaggagaccccagggaatacttggccaactttatcaaaatcggggaaggctcaaccggcatcgtatgcatcgccaccgagaaacacacagggaaacaagttgcagtgaagaaaatggacctccggaagcaacagagacgagaactgcttttcaatgaggtcgtgatcatgcgggattaccaccatgacaatgtggttgacatgtacagcagctaccttgtcggcgatgagctctgggtggtcatggagtttctagaaggtggtgccttgacagacattgtgactcacaccagaatgaatgaagaacagatagctactgtctgcctgtcagttctgagagctctctcctaccttcataaccaaggagtgattcacagggacataaaaagtgactccatcctcctgacaagcgatggccggataaagttgtctgattttggtttctgtgctcaagtttccaaagaggtgccgaagaggaaatcattggttggcactccctactggatggcccctgaggtgatttctaggctaccttatgggacagaggtggacatctggtccctcgggatcatggtgatagaaatgattgatggcgagcccccctacttcaatgagcctcccctccaggcgatgcggaggatccgggacagtttacctccaagagtgaaggacctacacaaggtttcttcagtgctccggggattcctagacttgatgttggtgagggagccctctcagagagcaacagcccaggaactcctcggacatccattcttaaaactagcaggtccaccgtcttgcattgtccccctcatgagacaatacaggcatcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
- NCK interacting protein with SH3 domain
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 20

Buy PAK7-p21 protein (Cdc42/Rac)-activated kinase 7 Gene now

Add to cart