DDX21-DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 Gene View larger

DDX21-DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 Gene


New product

Data sheet of DDX21-DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDX21-DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004182
Product type: DNA & cDNA
Ncbi symbol: DDX21
Origin species: Human
Product name: DDX21-DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 Gene
Size: 2ug
Accessions: BC004182
Gene id: 9188
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
Synonyms: GUA; GURDB; RH-II/GU; RH-II/GuA; nucleolar RNA helicase 2; DEAD (Asp-Glu-Ala-Asp) box helicase 21; DEAD (Asp-Glu-Ala-Asp) box polypeptide 21; DEAD box protein 21; DEAD-box helicase 21; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21; Gu protein; RH II/Gu; RNA helicase II/Gu alpha; gu-alpha; nucleolar RNA helicase Gu; nucleolar RNA helicase II; DExD-box helicase 21
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattctcctaaatccaaaaaggcaaaaaagaaagaggagccatctcaaaatgacatttctcctaaaaccaaaagtttgagaaagaaaaaggagcccattgaaaagaaagtggtttcttctaaaaccaaaaaagtgacaaaaaatgaggagccttctgaggaagaaatagatgctcctaagcccaagaagatgaagaaagaaaaggaaatgaatggagaaactagagagaaaagccccaaactgaagaatggatttcctcatcctgaaccggactgtaaccccagtgaagctgccagtgaagaaagtaacagtgagatagagcaggaaatacctgtggaacaaaaagaaggcgctttctctaattttcccatatctgaagaaactattaaacttctcaaaggccgaggagtgaccttcctatttcctatacaagcaaagacattccatcatgtttacagcgggaaggacttaattgcacaggcacggacaggaactgggaagacattctcctttgccatccctttgattgagaaacttcatggggaactgcaagacaggaagagaggccgtgcccctcaggtactggttcttgcacctacaagagagttggcaaatcaagtaagcaaagacttcagtgacatcacaaaaaagctgtcagtggcttgtttttatggtggaactccctatggaggtcaatttgaacgcatgaggaatgggattgatatcctggttggaacaccaggtcgtatcaaagaccacatacagaatggcaaactagatctcaccaaacttaagcatgttgtcctggatgaagtggaccagatgttggatatgggatttgctgatcaagtggaagagattttaagtgtggcatacaagaaagattctgaagacaatccccaaacattgcttttttctgcaacttgccctcattgggtatttaatgttgccaagaaatacatgaaatctacatatgaacaggtggacctgattggtaaaaagactcagaaaacggcaataactgtggagcatctggctattaagtgccactggactcagagggcagcagttattggggatgtcatccgagtatatagtggtcatcaaggacgcactatcatcttttgtgaaaccaagaaagaagcccaggagctgtcccagaattcagctataaagcaggatgctcagtccttgcatggagacattccacagaagcaaagggaaatcaccctgaaaggttttagaaatggtagttttggagttttggtggcaaccaatgttgctgcacgtgggttagacatccctgaggttgatttggttatacaaagctctccaccaaaggatgtagagtcctacattcatcgatccgggcggacaggcagagctggaaggacgggggtgtgcatctgcttttatcagcacaaggaagaatatcagttagtacaagtggagcaaaaagcgggaattaagttcaaacgaataggtgttccttctgcaacagaaataataaaagcttccagcaaagatgccatcaggcttttggattccgtgcctcccactgccattagtcacttcaaacaatcagctgagaagctgatagaggagaagggagctgtggaagctctggcagcagcactggcccatatttcaggtgccacgtccgtagaccagcgctccttgatcaactcaaatgtgggttttgtgaccatgatcttgcagtgctcaattgaaatgccaaatattagttatgcttggaaagaacttaaagagcagctgggcgaggagattgattccaaagtgaagggaatggtttttctcaaaggaaagctgggtgtttgctttgatgtacctaccgcatcagtaacagaaatacaggagaaatggcatgattcacgacgctggcagctctctgtggccacagagcaaccagaactggaaggaccacgggaaggatatggaggcttcaggggacagcgggaaggcagtcgaggcttcaggggacagcgggacggaaacagaagattcagaggacagcgggaaggcagtagaggcccgagaggacagcgatcaggaggtggcaacaaaagtaacagatcccaaaacaaaggccagaagcggagtttcagtaaagcatttggtcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
- NCK interacting protein with SH3 domain
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
- CCCTC-binding factor (zinc finger protein)

Buy DDX21-DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 Gene now

Add to cart