Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PTHLH-parathyroid hormone-like hormone Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTHLH-parathyroid hormone-like hormone Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005961 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTHLH |
| Origin species: | Human |
| Product name: | PTHLH-parathyroid hormone-like hormone Gene |
| Size: | 2ug |
| Accessions: | BC005961 |
| Gene id: | 5744 |
| Gene description: | parathyroid hormone-like hormone |
| Synonyms: | BDE2; HHM; PLP; PTHR; PTHRP; parathyroid hormone-related protein; PTH-rP; PTH-related protein; osteostatin; parathyroid hormone-like hormone preproprotein; parathyroid hormone-like related protein; parathyroid hormone like hormone |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagcggagactggttcagcagtggagcgtcgcggtgttcctgctgagctacgcggtgccctcctgcgggcgctcggtggagggtctcagccgccgcctcaaaagagctgtgtctgaacatcagctcctccatgacaaggggaagtccatccaagatttacggcgacgattcttccttcaccatctgatcgcagaaatccacacagctgaaatcagagctacctcggaggtgtcccctaactccaagccctctcccaacacaaagaaccaccccgtccgatttgggtctgatgatgagggcagatacctaactcaggaaactaacaaggtggagacgtacaaagagcagccgctcaagacacctgggaagaaaaagaaaggcaagcccgggaaacgcaaggagcaggaaaagaaaaaacggcgaactcgctctgcctggttagactctggagtgactgggagtgggctagaaggggaccacctgtctgacacctccacaacgtcgctggagctcgattcacggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DENN/MADD domain containing 2D - myotubularin related protein 14 - unc-51-like kinase 4 (C. elegans) - ADAM metallopeptidase domain 15 |