ULK4-unc-51-like kinase 4 (C. elegans) Gene View larger

ULK4-unc-51-like kinase 4 (C. elegans) Gene


New product

Data sheet of ULK4-unc-51-like kinase 4 (C. elegans) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ULK4-unc-51-like kinase 4 (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014794
Product type: DNA & cDNA
Ncbi symbol: ULK4
Origin species: Human
Product name: ULK4-unc-51-like kinase 4 (C. elegans) Gene
Size: 2ug
Accessions: BC014794
Gene id: 54986
Gene description: unc-51-like kinase 4 (C. elegans)
Synonyms: serine/threonine-protein kinase ULK4; FAM7C1; REC01035; unc-51 like kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaactttattctgtatgaggagatcggaagaggaagcaagactgttgtctataaagggcgacggaagggaacaatcaattttgtagccattctttgtactgataagtgcaaaaggcctgaaataaccaactgggtccgtctcacccgtgaaataaaacacaagaatattgtaacttttcatgaatggtatgaaacaagcaaccacctctggctagtggtggaactctgcacaggtggttccttaaaaacagttattgctcaagatgaaaacctcccagaagatgttgtgagagaatttggaattgacctgattagtggattacatcatcttcataaacttggcattctcttttgtgacatttctcctaggaagatactcttggaagggcctggcacactgaagtttagcaacttttgcttggcaaaagtggaaggtgaaaatttggaagagttctttgctttggtggcagcagaggaaggaggaggtgataatggggaaaatgtcctgaagaaaagcatgaaaagtagagtcaaaggatctcctgtatatacagcaccagaagttgtgaggggtgctgacttttccatctccagtgacctctggtctttgggctgtctgctttatgaaatgttttcaggaaaacctccattcttctcagaaagtatttcagaattaactgaaaagatcttatgtgaagatcctttgccacctattccgaaagattcttctcgtcctaaagcttcttcagattttattaatttgcttgatgggttacttcaaagagatcctcagaaaagattgacttggacaaggctactgcagcattcattttggaagaaagcttttgctggagcagatcaggaatcaagcgtcgaagatctcagtctcagcagaaacactatggagtgttctgggccacaagattccaaggagcttttgcagaactctcagagtagacaagcaaaagggcacaagagtggtcaaccactaggtcactctttcagactagaaaatccaactgagtttcggcctaagagtactcttgagggtcaattgaatgaatccatgtttcttctcagttctcgtcctactcccagaactagcactgcagtggaagtaagtcctggtgaggatatgactcactgttcaccacagaagacttctcctctgaccaagattacaagtggacacctgagtcagcaggacctggaatcccagatgagagagcttatctacacggactcagatcttgttgtcacccccattatcgacaatccaaagataatgaaacagccaccagttaaatttgatgcaaaaatattgcatctaccaacatattcagtggataagttattatttctgaaagatcaagattggaatgactttttgcaacaagtgtgctcgcagatcgactccactgagaagagcatgggggcctcccgagccaagctgaatctcctttgctatttgtgcgtggtggctggtcaccaggaggtggccaccaggctcctccattcccccctgttccaattgctaatccagcatttgcggatagctccaaactgggatatacgggccaaggttgctcacgtaattggtttactggcttcgcacacagctgagctccaggaaaatacacctgttgttgagactacaagctccattggaatcgggattttgaactgtcttgttcaacactccactccagtgcctagacagtgccttgtgtatgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADAM metallopeptidase domain 15
- hypothetical protein MGC16169
- DENN/MADD domain containing 5A
- Sec23 homolog B (S. cerevisiae)

Buy ULK4-unc-51-like kinase 4 (C. elegans) Gene now

Add to cart