Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of U2AF1L4-U2 small nuclear RNA auxiliary factor 1-like 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about U2AF1L4-U2 small nuclear RNA auxiliary factor 1-like 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021186 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | U2AF1L4 |
| Origin species: | Human |
| Product name: | U2AF1L4-U2 small nuclear RNA auxiliary factor 1-like 4 Gene |
| Size: | 2ug |
| Accessions: | BC021186 |
| Gene id: | 199746 |
| Gene description: | U2 small nuclear RNA auxiliary factor 1-like 4 |
| Synonyms: | U2AF1-RS3; U2AF1L3; U2AF1L3V1; U2AF1RS3; U2af26; splicing factor U2AF 26 kDa subunit; U2 auxiliary factor 26; U2 small nuclear RNA auxiliary factor 1-like 3; U2 small nuclear RNA auxiliary factor 1-like protein 3; U2 small nuclear RNA auxiliary factor 1-like protein 4; U2(RNU2) small nuclear RNA auxiliary factor 1-like 3; U2(RNU2) small nuclear RNA auxiliary factor 1-like protein 3; U2AF1-like 4; U2AF1-like protein 3; U2 small nuclear RNA auxiliary factor 1 like 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgaatatttagcttcgatattcgggactgagaaggacaaggttaactgctctttttactttaagatcggggtctgccggcacggggaccggtgctcccggcttcacaacaagccgacattcagccaggaggtgttcacagaactgcaggagaagtatggggagattgaagagatgaatgtgtgcgacaaccttggggaccacgtcgtgggcaacgtctatgtcaagttccggagggaggaggatggagagcgggccgtggctgaactcagtaaccgctggttcaacgggcaggctgtgcacgggaatgtacccgaggtggcttctgcaacttcatgcatctgcggcccatttcccagaacctccagaggcagctctatgggcggggacccaggcgcaggtcacccccgaggttccatactggccacaatccccgagagaggaaccatcggtgttcccctgatcactggcatggccgcttctgaggccctggcccccttacccttcacccccaacagggacagatgttcctggcaggacctctcctcaaagcccccttcactctcctgccccatccttcccaggctcccgggctccataatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 18 (interferon-gamma-inducing factor) - tumor necrosis factor, alpha-induced protein 8 - CNDP dipeptidase 2 (metallopeptidase M20 family) - phosphodiesterase 1C, calmodulin-dependent 70kDa |