Cart 20 Product Products 4 334,81 € (empty)
-
1 x TMEM100-tr...113,40 € -
-
-
1 x PIGX-phosp...113,40 € -
1 x HMG20B-hig...121,50 € -
1 x HEPACAM2-H...121,50 € -
1 x β I...177,41 € -
1 x SH2D2A-SH2...121,50 € -
1 x GPN2-GPN-l...121,50 € -
1 x GPIHBP1-gl...113,40 € -
-
-
1 x TM2D1-TM2...113,40 € -
1 x PIGM-phosp...121,50 € -
1 x TMEM107-tr...113,40 € -
-
-
-
1 x FAM149B1-f...121,50 € -
1 x FAM127C-fa...113,40 €
No products
To be determined Shipping
4 334,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 20 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 334,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 334,81 €
View larger 
Data sheet of CNDP2-CNDP dipeptidase 2 (metallopeptidase M20 family) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CNDP2-CNDP dipeptidase 2 (metallopeptidase M20 family) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001375 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CNDP2 |
| Origin species: | Human |
| Product name: | CNDP2-CNDP dipeptidase 2 (metallopeptidase M20 family) Gene |
| Size: | 2ug |
| Accessions: | BC001375 |
| Gene id: | 55748 |
| Gene description: | CNDP dipeptidase 2 (metallopeptidase M20 family) |
| Synonyms: | CN2; CPGL; HEL-S-13; HsT2298; PEPA; cytosolic non-specific dipeptidase; carnosine dipeptidase II; cytosolic nonspecific dipeptidase; epididymis secretory protein Li 13; glutamate carboxypeptidase-like protein 1; peptidase A; CNDP dipeptidase 2 (metallopeptidase M20 family) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccctcactaccctgtttaagtacatagatgaaaatcaggatcgctacattaagaaactcgcaaaatgggtggctatccagagtgtgtctgcgtggccggagaagagaggcgaaatcaggaggatgatggaagttgctgctgcagatgttaagcagttggggggctctgtggaactggtggatatcggaaaacaaaagctccctgatggctcggagatcccgctccctcctattctgctcggcaggctgggctccgacccacagaagaagaccgtgtgcatttacgggcacctggatgtgcagcctgcagccctggaggacggctgggacagcgagcccttcaccctggtggagcgagacggcaagctgtatgggagaggttcgactgatgataagggcccggtggccggctggataaacgccctggaagcgtatcagaaaacaggccaggagattcctgtcaacgtccgattctgcctcgaaggcatggaggagtcaggctctgagggcctagacgagctgatttttgcccggaaagacacattctttaaggatgtggactatgtctgcatttctgacaattactggctgggaaagaagaagccctgcatcacctacggcctcaggggcatttgctactttttcatcgaggtggagtgcagcaacaaagacctccattctggggtgtacgggggctcggtgcatgaggccatgactgatctcattttgctgatgggctctttggtggacaagagggggaacatcctgatccccggcattaacgaggccgtggccgccgtcacggaagaggagcacaagctgtacgacgacatcgactttgacatagaggagtttgccaaggatgtgggggcgcagatcctcctgcacagccacaagaaagacatcctcatgcaccgatggcggtacccgtctctgtccctccatggcatcgaaggcgccttctctgggtctggggccaagaccgtgattcccaggaaggtggttggcaagttctccatcaggctcgtgccgaacatgactcctgaagtcgtcggcgagcaggtcacaagctacctaactaagaagtttgctgaactacgcagccccaatgagttcaaggtgtacatgggccacggtgggaagccctgggtctccgacttcagtcaccctcattacctggctgggagaagagccatgaagacagtttttggtgttgagccagacttgaccagggaaggcggcagtattcccgtgaccttgacctttcaggaggccacgggcaagaacgtcatgctgctgcctgtggggtcagcggatgacggagcccactcccagaatgaaaagctcaacaggtataactacatagagggaaccaagatgctggccgcgtacctgtatgaggtctcccagctgaaggactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphodiesterase 1C, calmodulin-dependent 70kDa - POT1 protection of telomeres 1 homolog (S. pombe) - radial spoke head 10 homolog B (Chlamydomonas) - aryl-hydrocarbon receptor nuclear translocator 2 |