> >>CATSPER2-cation channel, sperm associated 2 Gene
CATSPER2-cation channel, sperm associated 2 Gene View larger

CATSPER2-cation channel, sperm associated 2 Gene

PTXBC028728

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of CATSPER2-cation channel, sperm associated 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CATSPER2-cation channel, sperm associated 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028728
Product type: DNA & cDNA
Ncbi symbol: CATSPER2
Origin species: Human
Product name: CATSPER2-cation channel, sperm associated 2 Gene
Size: 2ug
Accessions: BC028728
Gene id: 117155
Gene description: cation channel, sperm associated 2
Synonyms: cation channel sperm-associated protein 2; sperm ion channel; cation channel sperm associated 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcttaccaacaagaagagcagatgcagcttccccgagctgatgccattcgttcacgtctcatcgatactttctctctcattgagcatttgcaaggcttgagccaagctgtgccgcggcacactatcaggaagttacttgatccttcccgccagaagaaacttgtattgggagatcaacaccagctagtgcgtttctctataaagcctcagcgtatagaacagatttcacatgcccagaggctgttgagcaggcttcatgtgcgctgcagtcagaggccacctctttctttgtgggccggatgggtccttgagtgtcctctcttcaaaaacttcatcatcttcctggtctttttgaatacgatcatattgatggttgaaatagaattgctggaatccacaaataccaaactatggccattgaagctgaccttggaggtggcagcttggtttatcttgcttattttcatcctggagatccttcttaagtggctatccaacttttctgttttctggaagagtgcctggaatgtctttgactttgttgttaccatgttggtaaggatagagatcctgagggttcgtttagtgggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - activation-induced cytidine deaminase
- single stranded DNA binding protein 3
- thyroid hormone receptor interactor 6
- Holliday junction recognition protein

Reviews

Buy CATSPER2-cation channel, sperm associated 2 Gene now

Add to cart