Cart 37 Product Products 4 544,80 € (empty)
-
1 x C9orf11-ch...113,40 € -
1 x MLLT11-mye...113,40 € -
1 x MGC31957-h...113,40 € -
1 x KDELR3-KDE...113,40 € -
1 x PARD6A-par...121,50 € -
1 x TMEM144-tr...121,50 € -
-
1 x KLK2-kalli...113,40 € -
1 x LUC7L-LUC7...121,50 € -
1 x LSM14B-LSM...113,40 € -
1 x RPA2-repli...121,50 € -
1 x ING3-inhib...113,40 € -
1 x EDA-ectody...121,50 € -
1 x ANKDD1A-an...121,50 € -
1 x Goat...219,00 € -
1 x B4GALNT1-b...121,50 € -
1 x KCNK1-pota...121,50 € -
1 x LTBR-lymph...121,50 € -
1 x MGC21881-h...113,40 € -
1 x EGFL7-EGF-...121,50 € -
1 x PPIG-pepti...121,50 € -
1 x KCNJ11-pot...121,50 € -
-
1 x GNMT-glyci...121,50 € -
1 x KCNK16-pot...121,50 € -
1 x MGC3196-hy...113,40 € -
1 x COMMD6-COM...113,40 € -
-
1 x LUC7L2-LUC...121,50 € -
1 x SLC10A1-so...121,50 € -
1 x FAM19A1-fa...113,40 € -
1 x PLP2-prote...113,40 € -
1 x PNO1-partn...113,40 € -
1 x KRT18-kera...121,50 € -
1 x KHDRBS2-KH...121,50 € -
1 x ISG20-inte...113,40 € -
1 x KCNN2-pota...113,40 €
No products
To be determined Shipping
4 544,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 37 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 544,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 544,80 €
View larger 
Data sheet of AICDA-activation-induced cytidine deaminase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AICDA-activation-induced cytidine deaminase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006296 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AICDA |
| Origin species: | Human |
| Product name: | AICDA-activation-induced cytidine deaminase Gene |
| Size: | 2ug |
| Accessions: | BC006296 |
| Gene id: | 57379 |
| Gene description: | activation-induced cytidine deaminase |
| Synonyms: | AID; ARP2; CDA2; HEL-S-284; HIGM2; single-stranded DNA cytosine deaminase; cytidine aminohydrolase; epididymis secretory protein Li 284; integrated into Burkitt's lymphoma cell line Ramos |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - single stranded DNA binding protein 3 - thyroid hormone receptor interactor 6 - Holliday junction recognition protein - acyl-Coenzyme A oxidase 3, pristanoyl |