Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDKN2D-cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Gene
PTXBC001822
New product
Data sheet of CDKN2D-cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDKN2D-cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001822 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDKN2D |
| Origin species: | Human |
| Product name: | CDKN2D-cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Gene |
| Size: | 2ug |
| Accessions: | BC001822 |
| Gene id: | 1032 |
| Gene description: | cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) |
| Synonyms: | INK4D; p19; p19-INK4D; cyclin-dependent kinase 4 inhibitor D; CDK inhibitor p19INK4d; cell cycle inhibitor, Nur77 associating protein; cyclin-dependent kinase 4 inhibitor D p19; cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4); inhibitor of cyclin-dependent kinase 4d; cyclin dependent kinase inhibitor 2D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctggaggaggttcgcgccggcgaccggctgagtggggcggcggcccggggcgacgtgcaggaggtgcgccgccttctgcaccgcgagctggtgcatcccgacgccctcaaccgcttcggcaagacggcgctgcaggtcatgatgtttggcagcaccgccatcgccctggagctgctgaagcaaggtgccagccccaatgtccaggacacctccggtaccagtccagtccatgacgcagcccgcactggattcctggacaccctgaaggtcctagtggagcacggggctgatgtcaacgtgcctgatggcaccggggcacttccaatccatctggcagttcaagagggtcacactgctgtggtcagctttctggcagctgaatctgatctccatcgcagggacgccaggggtctcacacccttggagctggcactgcagagaggggctcaggacctcgtggacatcctgcagggccacatggtggccccgctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulatory factor X, 4 (influences HLA class II expression) - chaperone, ABC1 activity of bc1 complex homolog (S. pombe) - regulatory factor X, 4 (influences HLA class II expression) - transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) |