Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPIB-peptidylprolyl isomerase B (cyclophilin B) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPIB-peptidylprolyl isomerase B (cyclophilin B) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001125 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPIB |
| Origin species: | Human |
| Product name: | PPIB-peptidylprolyl isomerase B (cyclophilin B) Gene |
| Size: | 2ug |
| Accessions: | BC001125 |
| Gene id: | 5479 |
| Gene description: | peptidylprolyl isomerase B (cyclophilin B) |
| Synonyms: | CYP-S1; CYPB; HEL-S-39; OI9; SCYLP; peptidyl-prolyl cis-trans isomerase B; PPIase B; S-cyclophilin; cyclophilin-like protein; epididymis secretory protein Li 39; peptidylprolyl isomerase B (cyclophilin B); rotamase B; peptidylprolyl isomerase B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcgcctctccgaacgcaacatgaaggtgctccttgccgccgccctcatcgcggggtccgtcttcttcctgctgctgccgggaccttctgcggccgatgagaagaagaaggggcccaaagtcaccgtcaaggtgtattttgacctacgaattggagatgaagatgtaggccgggtgatctttggtctcttcggaaagactgttccaaaaacagtggataattttgtggccttagctacaggagagaaaggatttggctacaaaaacagcaaattccatcgtgtaatcaaggacttcatgatccagggcggagacttcaccaggggagatggcacaggaggaaagagcatctacggtgagcgcttccccgatgagaacttcaaactgaagcactacgggcctggctgggtgagcatggccaacgcaggcaaagacaccaacggctcccagttcttcatcacgacagtcaagacagcctggctagatggcaagcatgtggtgtttggcaaagttctagagggcatggaggtggtgcggaaggtggagagcaccaagacagacagccgggataaacccctgaaggatgtgatcatcgcagactgcggcaagatcgaggtggagaagccctttgccatcgccaaggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box and WD repeat domain containing 11 - lymphocyte-specific protein tyrosine kinase - spermidine/spermine N1-acetyltransferase 1 - F-box and leucine-rich repeat protein 13 |