Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SAT1-spermidine/spermine N1-acetyltransferase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SAT1-spermidine/spermine N1-acetyltransferase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002503 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SAT1 |
| Origin species: | Human |
| Product name: | SAT1-spermidine/spermine N1-acetyltransferase 1 Gene |
| Size: | 2ug |
| Accessions: | BC002503 |
| Gene id: | 6303 |
| Gene description: | spermidine/spermine N1-acetyltransferase 1 |
| Synonyms: | DC21; KFSD; KFSDX; SAT; SSAT; SSAT-1; diamine acetyltransferase 1; diamine N-acetyltransferase 1; polyamine N-acetyltransferase 1; putrescine acetyltransferase; spermidine/spermine N1-acetyltransferase alpha; spermidine/spermine N1-acetyltransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaaattcgtgatccgcccagccactgccgccgactgcagtgacatactgcggctgatcaaggagctggctaaatatgaatacatggaagaacaagtaatcttaactgaaaaagatctgctagaagatggttttggagagcaccccttttaccactgcctggttgcagaagtgccgaaagagcactggactccggaaggacacagcattgttggttttgccatgtactattttacctatgacccgtggattggcaagttattgtatcttgaggacttcttcgtgatgagtgattatagaggctttggcataggatcagaaattctgaagaatctaagccaggttgcaatgaggtgtcgctgcagcagcatgcacttcttggtagcagaatggaatgaaccatccatcaacttctataaaagaagaggtgcttctgatctgtccagtgaagagggttggagactgttcaagatcgacaaggagtacttgctaaaaatggcaacagaggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box and leucine-rich repeat protein 13 - zinc finger and BTB domain containing 44 - ring finger and SPRY domain containing 1 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 |