Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PIN1-peptidylprolyl cis/trans isomerase, NIMA-interacting 1 Gene
PTXBC002899
New product
Data sheet of PIN1-peptidylprolyl cis/trans isomerase, NIMA-interacting 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIN1-peptidylprolyl cis/trans isomerase, NIMA-interacting 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002899 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIN1 |
| Origin species: | Human |
| Product name: | PIN1-peptidylprolyl cis/trans isomerase, NIMA-interacting 1 Gene |
| Size: | 2ug |
| Accessions: | BC002899 |
| Gene id: | 5300 |
| Gene description: | peptidylprolyl cis/trans isomerase, NIMA-interacting 1 |
| Synonyms: | rotamase Pin1; PPIase Pin1; DOD; UBL5; peptidyl-prolyl cis-trans isomerase NIMA-interacting 1; protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1; peptidylprolyl cis/trans isomerase, NIMA-interacting 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggacgaggagaagctgccgcccggctgggagaagcgcatgagccgcagctcaggccgagtgtactacttcaaccacatcactaacgccagccagtgggagcggcccagcggcaacagcagcagtggtggcaaaaacgggcagggggagcctgccagggtccgctgctcgcacctgctggtgaagcacagccagtcacggcggccctcgtcctggcggcaggagaagatcacccggaccaaggaggaggccctggagctgatcaacggctacatccagaagatcaagtcgggagaggaggactttgagtctctggcctcacagttcagcgactgcagctcagccaaggccaggggagacctgggtgccttcagcagaggtcagatgcagaagccatttgaagacgcctcgtttgcgctgcggacgggggagatgagcgggcccgtgttcacggattccggcatccacatcatcctccgcactgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor GTPase activating protein 3 - TEL2, telomere maintenance 2, homolog (S. cerevisiae) - coatomer protein complex, subunit beta 2 (beta prime) - sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 |