Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of APCS-amyloid P component, serum Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APCS-amyloid P component, serum Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007039 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APCS |
| Origin species: | Human |
| Product name: | APCS-amyloid P component, serum Gene |
| Size: | 2ug |
| Accessions: | BC007039 |
| Gene id: | 325 |
| Gene description: | amyloid P component, serum |
| Synonyms: | HEL-S-92n; PTX2; SAP; serum amyloid P-component; 9.5S alpha-1-glycoprotein; epididymis secretory sperm binding protein Li 92n; pentaxin-related; pentraxin-2; pentraxin-related; amyloid P component, serum |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacaagccgctgctttggatctctgtcctcaccagcctcctggaagcctttgctcacacagacctcagtgggaaggtgtttgtatttcctagagaatctgttactgatcatgtaaacttgatcacaccgctggagaagcctctacagaactttaccttgtgttttcgagcctatagtgatctctctcgtgcctacagcctcttctcctacaatacccaaggcagggataatgagctactagtttataaagaaagagttggagagtatagtctatacattggaagacacaaagttacatccaaagttatcgaaaagttcccggctccagtgcacatctgtgtgagctgggagtcctcatcaggtattgctgaattttggatcaatgggacacctttggtgaaaaagggtctgcgacagggttactttgtggaagctcagcccaagattgtcctggggcaggaacaggattcctatgggggcaagtttgataggagccagtcctttgtgggagagattggggatttgtacatgtgggactctgtgctgcccccagaaaatatcctgtctgcctatcagggtacccctctccctgccaatatcctggactggcaggctctgaactatgaaatcagaggatatgtcatcatcaaacccttggtgtgggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 31 - transmembrane protein 47 - tRNA phosphotransferase 1 - WDYHV motif containing 1 |