Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of WDYHV1-WDYHV motif containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WDYHV1-WDYHV motif containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008781 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WDYHV1 |
| Origin species: | Human |
| Product name: | WDYHV1-WDYHV motif containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC008781 |
| Gene id: | 55093 |
| Gene description: | WDYHV motif containing 1 |
| Synonyms: | C8orf32; protein N-terminal glutamine amidohydrolase; N-terminal Gln amidase; WDYHV motif-containing protein 1; nt(Q)-amidase; protein NH2-terminal glutamine deamidase; WDYHV motif containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaggtaatggccccgctgctgtccactaccagccggccagccccccgcgggacgcctgcgtctacagcagctgctactgtgaagaaaatgtttggaagctctgtgaatacatcaaaaaccatgaccagtatcctttagaagaatgttatgctgtcttcatatctaatgagaggaagatgatacctatctggaaacaacaggcgagacctggagatggacctgtgatctgggattaccatgttgttttgcttcatgtttcaagtggaggacagagcttcatttatgatctcgatactgtcttgccatttccctgcctctttgacacttatgtagaagatgccattaagtctgatgatgacattcacccacagtttaggaggaaatttagagtgatctgtgcagattcatatttgaagaactttgcttctgaccgatctcacatgaaagactccagtgggaattggagagagcctccgccgccatatccctgcattgagactggagattccaaaatgaacctgaacgatttcatcagtatggatcccaaggtaggatggggcgccgtctacacactatccgaatttacacatcggtttggcagtaaaaactgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centrosomal protein 70kDa - ligand of numb-protein X 1 - centrosomal protein 68kDa - glutaminyl-tRNA synthetase |