Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT16-nudix (nucleoside diphosphate linked moiety X)-type motif 16 Gene
PTXBC031215
New product
Data sheet of NUDT16-nudix (nucleoside diphosphate linked moiety X)-type motif 16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT16-nudix (nucleoside diphosphate linked moiety X)-type motif 16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031215 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT16 |
| Origin species: | Human |
| Product name: | NUDT16-nudix (nucleoside diphosphate linked moiety X)-type motif 16 Gene |
| Size: | 2ug |
| Accessions: | BC031215 |
| Gene id: | 131870 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 16 |
| Synonyms: | U8 snoRNA-decapping enzyme; IDP phosphatase; IDPase; U8 snoRNA-binding protein H29K; inosine diphosphate phosphatase; m7GpppN-mRNA hydrolase; nucleoside diphosphate-linked moiety X motif 16; nudix (nucleoside diphosphate linked moiety X)-type motif 16; nudix motif 16; testicular tissue protein Li 129; nudix hydrolase 16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcttcggccgcatcccgctgcgctacgccatactgatgcagatgcgcttcgatggacgcctgggcttccccggcggattcgtggacacgcaggacagaagcctagaggacgggctgaaccgcgagctgcgcgaggagctgggcgaagcggctgccgctttccgcgtggagcgcactgactaccgcagctcccacgtcgggtcagggccacgcgttgtggcccacttctatgccaagcgtctgacgctcgaggagctgttggctgtggaggccggcgcaacacgcgccaaggaccacgggctggaggtgctgggcctggtgcgagtgcccctgtataccctgcgggatggtgtaggaggcctgcctaccttcctggagaattcctttattggctctgcgcgggagcagttacttgaagctctccaggacttgggactgctgcagtctggctctatttcaggccttaagattccagctcatcactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier organic anion transporter family, member 1C1 - integrin, alpha X (complement component 3 receptor 4 subunit) - phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) - caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) |