Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2G1-ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) Gene
PTXBC002775
New product
Data sheet of UBE2G1-ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2G1-ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002775 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2G1 |
| Origin species: | Human |
| Product name: | UBE2G1-ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC002775 |
| Gene id: | 7326 |
| Gene description: | ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) |
| Synonyms: | E217K; UBC7; UBE2G; ubiquitin-conjugating enzyme E2 G1; E2 ubiquitin-conjugating enzyme G1; ubiquitin carrier protein G1; ubiquitin conjugating enzyme E2G 1; ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans); ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast); ubiquitin-conjugating enzyme E2G 1 (homologous to C. elegans UBC7); ubiquitin-protein ligase G1; ubiquitin conjugating enzyme E2 G1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggagctgcagtcggcactgctactgcgaagacagctggcagaactcaacaaaaatccagtggaaggcttttctgcaggtttaatagatgacaatgatctctaccgatgggaagtccttattattggccctccagatacactttatgaaggtggtgtttttaaggctcatcttactttcccaaaagattatcccctccgacctcctaaaatgaaattcattacagaaatctggcacccaaatgttgataaaaatggtgatgtgtgcatttctattcttcatgagcctggggaagataagtatggttatgaaaagccagaggaacgctggctccctatccacactgtggaaaccatcatgattagtgtcatttctatgctggcagaccctaatggagactcacctgctaatgttgatgctgcgaaagaatggagggaagatagaaatggagaatttaaaagaaaagttgcccgctgtgtaagaaaaagccaagagactgcttttgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MRE11 meiotic recombination 11 homolog A (S. cerevisiae) - phosphatidylinositol-4-phosphate 5-kinase, type I, beta - leucine rich repeat and sterile alpha motif containing 1 - glioma-associated oncogene homolog 1 (zinc finger protein) |