Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MRE11A-MRE11 meiotic recombination 11 homolog A (S. cerevisiae) Gene
PTXBC005241
New product
Data sheet of MRE11A-MRE11 meiotic recombination 11 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRE11A-MRE11 meiotic recombination 11 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005241 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRE11A |
| Origin species: | Human |
| Product name: | MRE11A-MRE11 meiotic recombination 11 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC005241 |
| Gene id: | 4361 |
| Gene description: | MRE11 meiotic recombination 11 homolog A (S. cerevisiae) |
| Synonyms: | double-strand break repair protein MRE11A; MRE11A; ATLD; HNGS1; MRE11B; AT-like disease; DNA recombination and repair protein; MRE11 double strand break repair nuclease A; MRE11 homolog 1; MRE11 homolog A; MRE11 homolog A, double strand break repair nuclease; MRE11 homolog, double strand break repair nuclease A; MRE11 meiotic recombination 11 homolog A; MRE11 meiotic recombination 11-like protein A; endo/exonuclease Mre11; meiotic recombination 11 homolog 1; meiotic recombination 11 homolog A; MRE11 homolog, double strand break repair nuclease |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtactgcagatgcacttgatgatgaaaacacatttaaaatattagttgcaacagatattcatcttggatttatggagaaagatgcagtcagaggaaatgatacgtttgtaacactcgatgaaattttaagacttgcccaggaaaatgaagtggattttattttgttaggtggtgatctttttcatgaaaataagccctcaaggaaaacattacatacctgcctcgagttattaagaaaatattgtatgggtgatcggcctgtccagtttgaaattctcagtgatcagtcagtcaactttggttttagtaagtttccatgggtgaactatcaagatggcaacctcaacatttcaattccagtgtttagtattcatggcaatcatgacgatcccacaggggcagatgcactttgtgccttggacattttaagttgtgctggatttgtaaatcactttggacgttcaatgtctgtggagaagatagacattagtccggttttgcttcaaaaaggaagcacaaagattgcgctatatggtttaggatccattccagatgaaaggctctatcgaatgtttgtcaataaaaaagtaacaatgttgagaccaaaggaagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol-4-phosphate 5-kinase, type I, beta - leucine rich repeat and sterile alpha motif containing 1 - glioma-associated oncogene homolog 1 (zinc finger protein) - ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 |