Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TRIP11-thyroid hormone receptor interactor 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRIP11-thyroid hormone receptor interactor 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002656 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRIP11 |
| Origin species: | Human |
| Product name: | TRIP11-thyroid hormone receptor interactor 11 Gene |
| Size: | 2ug |
| Accessions: | BC002656 |
| Gene id: | 9321 |
| Gene description: | thyroid hormone receptor interactor 11 |
| Synonyms: | ACG1A; CEV14; GMAP-210; GMAP210; TRIP-11; TRIP230; thyroid receptor-interacting protein 11; Golgi-microtubule-associated protein of 210 kDa; TR-interacting protein 11; clonal evolution-related gene on chromosome 14 protein; golgi-associated microtubule-binding protein 210; thyroid hormone receptor interactor 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtcctggcttgggggcctcggctccggattgggccagtctctgggtcaagtcgggggcagcctggcttccctcactggccagatatcaaactttacaaaggatatgctgatggagggcacggaggaagtggaagcagaattacctgattctaggacaaaggaaattgaagccattcatgcaatcttgagatcagagttgcctttgtgtacacacctgctttcagccttctacatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - anaphase promoting complex subunit 10 - NFKB inhibitor interacting Ras-like 2 - CASP8 and FADD-like apoptosis regulator - ankyrin repeat and SOCS box-containing 3 |