Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CFLAR-CASP8 and FADD-like apoptosis regulator Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CFLAR-CASP8 and FADD-like apoptosis regulator Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001602 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CFLAR |
| Origin species: | Human |
| Product name: | CFLAR-CASP8 and FADD-like apoptosis regulator Gene |
| Size: | 2ug |
| Accessions: | BC001602 |
| Gene id: | 8837 |
| Gene description: | CASP8 and FADD-like apoptosis regulator |
| Synonyms: | CASH; CASP8AP1; CLARP; Casper; FLAME; FLAME-1; FLAME1; I-FLICE; MRIT; c-FLIP; c-FLIPL; c-FLIPR; c-FLIPS; CASP8 and FADD-like apoptosis regulator; FADD-like antiapoptotic molecule 1; MACH-related inducer of toxicity; caspase homolog; caspase-eight-related protein; caspase-like apoptosis regulatory protein; caspase-related inducer of apoptosis; cellular FLICE-like inhibitory protein; inhibitor of FLICE; testis secretory sperm-binding protein Li 233m; usurpin beta; CASP8 and FADD like apoptosis regulator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgctgaagtcatccatcaggttgaagaagcacttgatacagatgagaaggagatgctgctctttttgtgccgggatgttgctatagatgtggttccacctaatgtcagggaccttctggatattttacgggaaagaggtaagctgtctgtcggggacttggctgaactgctctacagagtgaggcgatttgacctgctcaaacgtatcttgaagatggacagaaaagctgtggagacccacctgctcaggaaccctcaccttgtttcggactatagagtgctgatggcagagattggtgaggatttggataaatctgatgtgtcctcattaattttcctcatgaaggattacatgggccgaggcaagataagcaaggagaagagtttcttggaccttgtggttgagttggagaaactaaatctggttgccccagatcaactggatttattagaaaaatgcctaaagaacatccacagaatagacctgaagacaaaaatccagaagtacaagcagtctgttcaaggagcagggacaagttacaggaatgttctccaagcagcaatccaaaagagtctcaaggatccttcaaataacttcaggctccataatgggagaagtaaagaacaaagacttaaggaacagcttggcgctcaacaagaaccagtgaagaaatccattcaggaatcagaagcttttttgcctcagagcatacctgaagagagatacaagatgaagagcaagcccctaggaatctgcctgataatcgattgcattggcaatgagacagagcttcttcgagacaccttcacttccctgggctatgaagtccagaaattcttgcatctcagtatgcatggtatatcccagattcttggccaatttgcctgtatgcccgagcaccgagactacgacagctttgtgtgtgtcctggtgagccgaggaggctcccagagtgtgtatggtgtggatcagactcactcagggctccccctgcatcacatcaggaggatgttcatgggagattcatgcccttatctagcagggaagccaaagatgttttttattcagaactatgtggtgtcagagggccagctggaggacagcagcctcttggaggtggatgggccagcgatgaagaatgtggaattcaaggctcagaagcgagggctgtgcacagttcaccgagaagctgacttcttctggagcctgtgtactgcggacatgtccctgctggagcagtctcacagctcaccatccctgtacctgcagtgcctctcccagaaactgagacaagaaagaaaacgcccactcctggatcttcacattgaactcaatggctacatgtatgattggaacagcagagtttctgccaaggagaaatattatgtctggctgcagcacactctgagaaagaaacttatcctctcctacacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat and SOCS box-containing 3 - heat shock 60kDa protein 1 (chaperonin) - fermitin family homolog 3 (Drosophila) - glutamate decarboxylase 1 (brain, 67kDa) |