Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CEBPG-CCAAT/enhancer binding protein (C/EBP), gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CEBPG-CCAAT/enhancer binding protein (C/EBP), gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007582 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CEBPG |
| Origin species: | Human |
| Product name: | CEBPG-CCAAT/enhancer binding protein (C/EBP), gamma Gene |
| Size: | 2ug |
| Accessions: | BC007582 |
| Gene id: | 1054 |
| Gene description: | CCAAT/enhancer binding protein (C/EBP), gamma |
| Synonyms: | GPE1BP; IG/EBP-1; CCAAT/enhancer-binding protein gamma; CCAAT/enhancer binding protein (C/EBP), gamma; c/EBP gamma; CCAAT/enhancer binding protein gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcaagatatcgcagcaaaacagcactccaggggtgaacggaattagtgttatccatacccaggcacatgccagcggcttacagcaggttcctcagctggtgcctgctggccctgggggaggaggcaaagctgtggctcccagcaagcagagcaaaaagagttcgcccatggatcgaaacagtgacgagtatcggcaacgccgagagaggaacaacatggctgtgaaaaagagccggttgaaaagcaagcagaaagcacaagacacactgcagagagtcaatcagctcaaagaagagaatgaacggttggaagcaaaaatcaaattgctgaccaaggaattaagtgtactcaaagatttgtttcttgagcatgcacacaaccttgcagacaacgtacagtccattagcactgaaaatacgacagcagatggcgacaatgcaggacagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peptidylprolyl isomerase (cyclophilin)-like 3 - N-acetyltransferase 9 (GCN5-related, putative) - N-acetyltransferase 5 (GCN5-related, putative) - peptidylprolyl isomerase (cyclophilin)-like 2 |