Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NAT5-N-acetyltransferase 5 (GCN5-related, putative) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NAT5-N-acetyltransferase 5 (GCN5-related, putative) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005181 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NAT5 |
| Origin species: | Human |
| Product name: | NAT5-N-acetyltransferase 5 (GCN5-related, putative) Gene |
| Size: | 2ug |
| Accessions: | BC005181 |
| Gene id: | 51126 |
| Gene description: | N-acetyltransferase 5 (GCN5-related, putative) |
| Synonyms: | natB complex subunit NAT5; N-terminal acetyltransferase B complex catalytic subunit NAT5; NAT5; NAT3; NAT3P; NAT5P; dJ1002M8.1; N-alpha-acetyltransferase 20; N-acetyltransferase 3 homolog; N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae); N-acetyltransferase 5 (GCN5-related, putative); N-acetyltransferase 5, ARD1 subunit (arrest-defective 1, S. cerevisiae, homolog); N-terminal acetyltransferase B complex catalytic subunit NAA20; N-terminal acetyltransferase complex ARD1 subunit; methionine N-acetyltransferase; natB catalytic subunit; N(alpha)-acetyltransferase 20, NatB catalytic subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccacgctacgggcctttacctgcgacgacctgttccgcttcaacaacattaacttggatccacttacagaaacttatgggattcctttctacctacaatacctcgcccactggccagagtatttcattgttgcagaggcacctggtggagaattaatgggttatattatgggtaaagcagaaggctcagtagctagggaagaatggcacgggcacgtcacagctctgtctgttgccccagaatttcgacgccttggtttggctgctaaacttatggagttactagaggagatttcagaaagaaagggtggattttttgtggatctctttgtaagagtatctaaccaagttgcagttaacatgtacaagcagttgggctacagtgtatataggacggtcatagagtactattcggccagcaacggggagcctgatgaggacgcttatgatatgaggaaagcactttccagggatactgagaagaaatccatcataccattacctcatcctgtgaggcctgaagacattgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peptidylprolyl isomerase (cyclophilin)-like 2 - pyruvate dehydrogenase phosphatase isoenzyme 2 - glycoprotein Ib (platelet), alpha polypeptide - leucine-zipper-like transcription regulator 1 |