CDK2AP2-cyclin-dependent kinase 2 associated protein 2 Gene View larger

CDK2AP2-cyclin-dependent kinase 2 associated protein 2 Gene

PTXBC002850

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDK2AP2-cyclin-dependent kinase 2 associated protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDK2AP2-cyclin-dependent kinase 2 associated protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002850
Product type: DNA & cDNA
Ncbi symbol: CDK2AP2
Origin species: Human
Product name: CDK2AP2-cyclin-dependent kinase 2 associated protein 2 Gene
Size: 2ug
Accessions: BC002850
Gene id: 10263
Gene description: cyclin-dependent kinase 2 associated protein 2
Synonyms: DOC-1R; p14; cyclin-dependent kinase 2-associated protein 2; CDK2-associated protein 2; DOC-1-related protein; tumor suppressor deleted in oral cancer related 1; cyclin dependent kinase 2 associated protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctacaaacccatcgcccctgctcccagcagcacccctggctccagcacccctgggccgggcaccccggtccctacaggaagcgtcccgtcgccgtcgggctcagtgccaggagccggcgctcctttcagaccgctgtttaacgactttggaccgccttccatgggctacgtgcaggcgatgaagccacccggcgcccagggctcccagagcacctacacggacctgctgtcagtcatagaggagatgggcaaagagatccggcctacctatgctggcagcaagagcgccatggagcgcctgaagagaggtatcatccatgcccgggccctagtcagagagtgcctggcagagacagagcggaacgcccgcacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arachidonate 5-lipoxygenase-activating protein
- erythrocyte membrane protein band 4.1 like 4A
- U2 small nuclear RNA auxiliary factor 1-like 4
- interleukin 18 (interferon-gamma-inducing factor)

Buy CDK2AP2-cyclin-dependent kinase 2 associated protein 2 Gene now

Add to cart