SNRPE-small nuclear ribonucleoprotein polypeptide E Gene View larger

SNRPE-small nuclear ribonucleoprotein polypeptide E Gene

PTXBC002639

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNRPE-small nuclear ribonucleoprotein polypeptide E Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNRPE-small nuclear ribonucleoprotein polypeptide E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002639
Product type: DNA & cDNA
Ncbi symbol: SNRPE
Origin species: Human
Product name: SNRPE-small nuclear ribonucleoprotein polypeptide E Gene
Size: 2ug
Accessions: BC002639
Gene id: 6635
Gene description: small nuclear ribonucleoprotein polypeptide E
Synonyms: HYPT11; SME; Sm-E; snRNP-E; small nuclear ribonucleoprotein E; sm protein E; small nuclear ribonucleoprotein polypeptide E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtaccgtggccagggtcagaaagtgcagaaggttatggtgcagcccatcaacctcatcttcagatacttacaaaatagatcgcggattcaggtgtggctctatgagcaagtgaatatgcggatagaaggctgtatcattggttttgatgagtatatgaaccttgtattagatgatgcagaagagattcattctaaaacaaagtcaagaaaacaactgggtcggatcatgctaaaaggagataatattactctgctacaaagtgtctccaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 5A2
- CCAAT/enhancer binding protein (C/EBP), gamma
- peptidylprolyl isomerase (cyclophilin)-like 3
- N-acetyltransferase 9 (GCN5-related, putative)

Buy SNRPE-small nuclear ribonucleoprotein polypeptide E Gene now

Add to cart