C7orf23-chromosome 7 open reading frame 23 Gene View larger

C7orf23-chromosome 7 open reading frame 23 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf23-chromosome 7 open reading frame 23 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf23-chromosome 7 open reading frame 23 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002837
Product type: DNA & cDNA
Ncbi symbol: C7orf23
Origin species: Human
Product name: C7orf23-chromosome 7 open reading frame 23 Gene
Size: 2ug
Accessions: BC002837
Gene id: 79161
Gene description: chromosome 7 open reading frame 23
Synonyms: transmembrane protein C7orf23; C7orf23; MM-TRAG; MMTRAG; transmembrane protein 243; MDR1 and mitochondrial taxol resistance associated; MDR1- and mitochondrial taxol resistance-associated protein; transmembrane protein 243, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggactttgctaccaggacctacggcaccagtggcctggacaacagacctctgtttggggagacgtccgccaaggatcgaatcatcaatttagttgttggcagcttaacatccttattgattctagtaacgctgataagtgcttttgttttccctcaactacctccaaaaccgttgaatatattctttgctgtctgcatctctttgagtagtattactgcctgcatacttatctactggtatcgacaaggagacttagaaccgaaatttagaaagctaatttactatatcatattttctatcatcatgttgtgtatatgtgcaaacctgtacttccatgatgtgggaaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine-rich protein 1 (intestinal)
- chromosome 9 open reading frame 64
- chromosome 9 open reading frame 16
- chromosome 1 open reading frame 91

Buy C7orf23-chromosome 7 open reading frame 23 Gene now

Add to cart