Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C7orf23-chromosome 7 open reading frame 23 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C7orf23-chromosome 7 open reading frame 23 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002837 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C7orf23 |
| Origin species: | Human |
| Product name: | C7orf23-chromosome 7 open reading frame 23 Gene |
| Size: | 2ug |
| Accessions: | BC002837 |
| Gene id: | 79161 |
| Gene description: | chromosome 7 open reading frame 23 |
| Synonyms: | transmembrane protein C7orf23; C7orf23; MM-TRAG; MMTRAG; transmembrane protein 243; MDR1 and mitochondrial taxol resistance associated; MDR1- and mitochondrial taxol resistance-associated protein; transmembrane protein 243, mitochondrial |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggactttgctaccaggacctacggcaccagtggcctggacaacagacctctgtttggggagacgtccgccaaggatcgaatcatcaatttagttgttggcagcttaacatccttattgattctagtaacgctgataagtgcttttgttttccctcaactacctccaaaaccgttgaatatattctttgctgtctgcatctctttgagtagtattactgcctgcatacttatctactggtatcgacaaggagacttagaaccgaaatttagaaagctaatttactatatcatattttctatcatcatgttgtgtatatgtgcaaacctgtacttccatgatgtgggaaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cysteine-rich protein 1 (intestinal) - chromosome 9 open reading frame 64 - chromosome 9 open reading frame 16 - chromosome 1 open reading frame 91 |