CRIP1-cysteine-rich protein 1 (intestinal) Gene View larger

CRIP1-cysteine-rich protein 1 (intestinal) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRIP1-cysteine-rich protein 1 (intestinal) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CRIP1-cysteine-rich protein 1 (intestinal) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002738
Product type: DNA & cDNA
Ncbi symbol: CRIP1
Origin species: Human
Product name: CRIP1-cysteine-rich protein 1 (intestinal) Gene
Size: 2ug
Accessions: BC002738
Gene id: 1396
Gene description: cysteine-rich protein 1 (intestinal)
Synonyms: CRHP; CRIP; CRP-1; CRP1; cysteine-rich protein 1; cysteine-rich heart protein; cysteine-rich intestinal protein; cysteine-rich protein 1 (intestinal); cysteine rich protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaagtgtcccaagtgcaacaaggaggtgtacttcgccgagagggtgacctctctgggcaaggactggcatcggccctgcctgaagtgcgagaaatgtgggaagacgctgacctctgggggccacgctgagcacgaaggcaaaccctactgcaaccacccctgctacgcagccatgtttgggcctaaaggctttgggcggggcggagccgagagccacactttcaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 64
- chromosome 9 open reading frame 16
- chromosome 1 open reading frame 91
- chromosome 2 open reading frame 40

Buy CRIP1-cysteine-rich protein 1 (intestinal) Gene now

Add to cart