MXD4-MAX dimerization protein 4 Gene View larger

MXD4-MAX dimerization protein 4 Gene

PTXBC002713

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MXD4-MAX dimerization protein 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MXD4-MAX dimerization protein 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002713
Product type: DNA & cDNA
Ncbi symbol: MXD4
Origin species: Human
Product name: MXD4-MAX dimerization protein 4 Gene
Size: 2ug
Accessions: BC002713
Gene id: 10608
Gene description: MAX dimerization protein 4
Synonyms: MAD4; MST149; MSTP149; bHLHc12; max dimerization protein 4; Mad4 homolog; class C basic helix-loop-helix protein 12; max dimerizer 4; max-associated protein 4; max-interacting transcriptional repressor MAD4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgaactccctgctgatcctgctggaggcggccgagtacctggagcgcagggatcgagaggccgagcacggctacgcctcggtgctgcccttcgacggcgacttcgccagggagaaaacaaaggcggccggcctggtgcgcaaggccccgaacaacaggcctcctcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ferritin, light polypeptide
- DPY30 domain containing 1
- amyloid P component, serum
- transmembrane protein 31

Buy MXD4-MAX dimerization protein 4 Gene now

Add to cart