DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene View larger

DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024013
Product type: DNA & cDNA
Ncbi symbol: DNAJB3
Origin species: Human
Product name: DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene
Size: 2ug
Accessions: BC024013
Gene id: 414061
Gene description: DnaJ (Hsp40) homolog, subfamily B, member 3
Synonyms: HCG3; dnaJ homolog subfamily B member 3; DnaJ (Hsp40) homolog, subfamily B, member 3; DnaJ heat shock protein family (Hsp40) member B3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggactactacgaggtgctggacgtgccccggcaggcctcatccgaggccatcaagaaggcgtaccgcaagctggcgctcaagtggcaccccgacaaaaaccctgagaacaaggaggaagcggagaggagattcaagcaggtggccgaggcctacgaggtgttgtcggacgccaagaaacgcgatatctatgaccgctatggcgaggcgggggcggagggcggctgcacaggcggcaggcccttcgaggaccccttcgagtacgtcttcagcttccgcgacccagccgacgtcttcagggagttcttcggcggccaggacccattctcctttgacctcttgggaaacccgctggagaatattttgggggggtcagaggaactgctggggaagcagaagcagagcgtctgcaccccttttctctgccttcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon stimulated exonuclease gene 20kDa
- related RAS viral (r-ras) oncogene homolog 2
- dynactin 1 (p150, glued homolog, Drosophila)
- aldehyde dehydrogenase 6 family, member A1

Buy DNAJB3-DnaJ (Hsp40) homolog, subfamily B, member 3 Gene now

Add to cart