Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RRAS2-related RAS viral (r-ras) oncogene homolog 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RRAS2-related RAS viral (r-ras) oncogene homolog 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013106 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RRAS2 |
| Origin species: | Human |
| Product name: | RRAS2-related RAS viral (r-ras) oncogene homolog 2 Gene |
| Size: | 2ug |
| Accessions: | BC013106 |
| Gene id: | 22800 |
| Gene description: | related RAS viral (r-ras) oncogene homolog 2 |
| Synonyms: | TC21; ras-related protein R-Ras2; ras-like protein TC21; teratocarcinoma oncogene; related RAS viral (r-ras) oncogene homolog 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcggccggctggcgggacggctccggccaggagaagtaccggctcgtggtggtcggcgggggcggcgtgggcaagtcggcgctcaccatccagttcatccagtcctattttgtaacggattatgatccaaccattgaagattcttacacaaagcagtgtgtgatagatgacagagcagcccggctagatattttggatacagcaggacaagaagagtttggagccatgagagaacagtatatgaggactggcgaaggcttcctgttggtcttttcagtcacagatagaggcagttttgaagaaatctataagtttcaaagacagattctcagagtaaaggatcgtgatgagttcccaatgattttaattggtaataaagcagatctggatcatcaaagacaggtaacacaggaagaaggacaacagttagcacggcagcttaaggtaacatacatggaggcatcagcaaagattaggatgaatgtagatcaagctttccatgaacttgtccgggttatcaggaaatttcaagagcaggaatgtcctccttcaccagaaccaacacggaaagaaaaagacaagaaaggctgccattgtgtcattttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynactin 1 (p150, glued homolog, Drosophila) - aldehyde dehydrogenase 6 family, member A1 - phosphoribosyl pyrophosphate amidotransferase - ABI family, member 3 (NESH) binding protein |