Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002638 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRIAP1 |
| Origin species: | Human |
| Product name: | TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene |
| Size: | 2ug |
| Accessions: | BC002638 |
| Gene id: | 51499 |
| Gene description: | TP53 regulated inhibitor of apoptosis 1 |
| Synonyms: | HSPC132; MDM35; P53CSV; WF-1; TP53-regulated inhibitor of apoptosis 1; mitochondrial distribution and morphology 35 homolog; p53-inducible cell-survival factor; protein 15E1.1; TP53 regulated inhibitor of apoptosis 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacagtgtgggggaggcatgcacggacatgaagcgcgagtacgaccagtgcttcaatcgctggttcgccgagaaatttctcaagggggacagctccggggacccgtgcaccgacctcttcaagcgctaccagcagtgtgttcagaaagcaataaaggagaaagagattcctattgaaggactggagttcatgggccatggcaaagaaaagcctgaaaattcttcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CDC28 protein kinase regulatory subunit 2 - chromosome 20 open reading frame 141 - coatomer protein complex, subunit zeta 1 - zinc finger, CCHC domain containing 13 |