TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene View larger

TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002638
Product type: DNA & cDNA
Ncbi symbol: TRIAP1
Origin species: Human
Product name: TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene
Size: 2ug
Accessions: BC002638
Gene id: 51499
Gene description: TP53 regulated inhibitor of apoptosis 1
Synonyms: HSPC132; MDM35; P53CSV; WF-1; TP53-regulated inhibitor of apoptosis 1; mitochondrial distribution and morphology 35 homolog; p53-inducible cell-survival factor; protein 15E1.1; TP53 regulated inhibitor of apoptosis 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacagtgtgggggaggcatgcacggacatgaagcgcgagtacgaccagtgcttcaatcgctggttcgccgagaaatttctcaagggggacagctccggggacccgtgcaccgacctcttcaagcgctaccagcagtgtgttcagaaagcaataaaggagaaagagattcctattgaaggactggagttcatgggccatggcaaagaaaagcctgaaaattcttcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDC28 protein kinase regulatory subunit 2
- chromosome 20 open reading frame 141
- coatomer protein complex, subunit zeta 1
- zinc finger, CCHC domain containing 13

Buy TRIAP1-TP53 regulated inhibitor of apoptosis 1 Gene now

Add to cart