Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of COPZ1-coatomer protein complex, subunit zeta 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COPZ1-coatomer protein complex, subunit zeta 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002849 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COPZ1 |
| Origin species: | Human |
| Product name: | COPZ1-coatomer protein complex, subunit zeta 1 Gene |
| Size: | 2ug |
| Accessions: | BC002849 |
| Gene id: | 22818 |
| Gene description: | coatomer protein complex, subunit zeta 1 |
| Synonyms: | CGI-120; COPZ; HSPC181; zeta-COP; zeta1-COP; coatomer subunit zeta-1; coatomer protein complex, subunit zeta; zeta-1 COP; zeta-1-coat protein; coatomer protein complex subunit zeta 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcgctgattttggaaccttccctgtatactgtcaaagccatcctgattctggacaatgatggagatcgactttttgccaagtactatgacgacacctaccccagtgtcaaggagcaaaaggcctttgagaagaacattttcaacaagacccatcggactgacagtgaaattgccctcttggaaggcctgacagtggtatacaaaagcagtatagatctctatttctatgtgattggcagctcctatgaaaatgagctgatgcttatggctgttctgaactgtctcttcgactcattgagccagatgctgaggaaaaatgtagaaaagcgagcactgctggagaacatggaggggctgttcttggctgtggatgaaattgtagatggaggggtgatcctagagagtgatccccagcaggtggtacaccgggtggcattaaggggtgaagatgtcccccttacggagcagaccgtgtctcaggtgctgcagtcagccaaagaacagatcaagtggtcactccttcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, CCHC domain containing 13 - plasma membrane proteolipid (plasmolipin) - chromosome 14 open reading frame 139 - zinc finger, MYND domain containing 11 |