NINJ1-ninjurin 1 Gene View larger

NINJ1-ninjurin 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NINJ1-ninjurin 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NINJ1-ninjurin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004440
Product type: DNA & cDNA
Ncbi symbol: NINJ1
Origin species: Human
Product name: NINJ1-ninjurin 1 Gene
Size: 2ug
Accessions: BC004440
Gene id: 4814
Gene description: ninjurin 1
Synonyms: NIN1; NINJURIN; ninjurin-1; nerve injury-induced protein-1; ninjurin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggccaacgcgtcccagctgaaggccgtcgtggaacagggccccagcttcgccttctatgtgcccctggtggtcctcatctccatctcccttgtgctgcagatcggcgtgggggtgctgctcatcttccttgtcaagtacgaccttaacaacccggccaagcacgccaagctggacttcctcaacaacctggccacgggcctggtgttcatcatcgtggtagtcaacatcttcatcacggccttcggggtccagaagcccttgatggacatggcaccccagcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuromedin B
- transgelin
- dynactin 6
- plexin A4

Buy NINJ1-ninjurin 1 Gene now

Add to cart