NMB-neuromedin B Gene View larger

NMB-neuromedin B Gene

PTXBC007407

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NMB-neuromedin B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NMB-neuromedin B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007407
Product type: DNA & cDNA
Ncbi symbol: NMB
Origin species: Human
Product name: NMB-neuromedin B Gene
Size: 2ug
Accessions: BC007407
Gene id: 4828
Gene description: neuromedin B
Synonyms: neuromedin-B; Neuromedin-B-32; neuromedin-beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccggcgggcggggggcgctcggatgttcggcagcctcctgctcttcgccctgctcgctgccggcgtcgccccgctcagctgggatctcccggagccccgcagccgagccagcaagatccgagtgcactcgcgaggcaacctctgggccaccggtcacttcatgggcaagaagagtctggagccttccagcccatccccattggggacagctacccacacctccctgagggaccagcgactgcagctgagtcatgatctgctcggaatcctcctgctaaagaaggctctgggcgtgagcctcagccgccccgcaccccaaatccaggaggctgctggtacaaatactgcagaaatgacaccaataatggggcagacacaacagcgtggcttagattgtgcccacccagggaaggtgctgaatgggaccctgttgatggccccatctggatgtaaatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transgelin
- dynactin 6
- plexin A4
- keratin 6A

Buy NMB-neuromedin B Gene now

Add to cart