Login to display prices
Login to display prices
HDAC6-histone deacetylase 6 Gene View larger

HDAC6-histone deacetylase 6 Gene

PTXBC005872

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HDAC6-histone deacetylase 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HDAC6-histone deacetylase 6 Gene

Proteogenix catalog: PTXBC005872
Ncbi symbol: HDAC6
Product name: HDAC6-histone deacetylase 6 Gene
Size: 2ug
Accessions: BC005872
Gene id: 10013
Gene description: histone deacetylase 6
Synonyms: CPBHM; HD6; JM21; PPP1R90; histone deacetylase 6; protein phosphatase 1, regulatory subunit 90
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacctcaaccggccaggattccaccacaaccaggcagcgaagaagtaggcagaacccccagtcgccccctcaggactccagtgtcacttcgaagcgaaatattaaaaagggagccgttccccgctctatccccaatctagcggaggtaaagaagaaaggcaaaatgaagaagctcggccaagcaatggaagaagacctaatcgtgggactgcaagggatggatctgaaccttgaggctgaagcactggctggcactggcttggtgttggatgagcagttaaatgaattccattgcctctgggatgacagcttcccggaaggccctgagcggctccatgccatcaaggagcaactgatccaggagggcctcctagatcgctgcgtgtcctttcaggcccggtttgctgaaaaggaagagctgatgttggttcacaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: